Sequence

GACUGAAGGGAGCUCCUUCUU

Expression details
CountSample IDExperiment title
2GSM707680Characterization of AGO1-/AGO4-associated smRNAs
2GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM277608Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM506662Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM707678Characterization of AGO1-/AGO4-associated smRNAs