Sequence

AAUGAUGCGGGAGAUAUUUU

Expression details
CountSample IDExperiment title
3GSM424743smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
2GSM707690Characterization of AGO1-/AGO4-associated smRNAs
1GSM284747A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM415786Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM518448small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM707682Characterization of AGO1-/AGO4-associated smRNAs