Sequence

AAAUAUCUGCCGACUCAUCCA

Expression details
CountSample IDExperiment title
23GSM304283ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
9GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
6GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
6GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
4GSM277608Highly integrated single base resolution maps of the epigenome in Arabidopsis
4GSM506666Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
4GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
4GSM506687Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
4GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM253623Small RNAs in four Argonaute complexes in Arabidopsis
3GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
3GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM506680Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM506681Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM343000AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
2GSM506678Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM575247Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
2GSM711894Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
1GSM154336Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM154368Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM277609Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM277610Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM387519Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
1GSM415786Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415788Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415789Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415790Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415796Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415797Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM506658Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506661Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506670Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506679Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506682Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506685Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506688Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518430MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM518447small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518448small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518453small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518454small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518456small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518459small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518460small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518467small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM605662Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707678Characterization of AGO1-/AGO4-associated smRNAs
1GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM711893Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings