Sequence

AUUAGCUUCCGACUCAUUCAUCCA

Expression details
CountSample IDExperiment title
2GSM506678Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM304284ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
1GSM366868Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
1GSM506668Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506669Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506675Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi