Sequence

AUGAAUGAUGCGGUAGACAA

Expression details
CountSample IDExperiment title
2GSM277608Highly integrated single base resolution maps of the epigenome in Arabidopsis
2GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM154367Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM415786Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415789Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415790Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415794Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi