AGCUUCCUUGAGUCCAUUCAC
| Count | Sample ID | Experiment title |
|---|---|---|
| 215 | GSM304283 | ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing |
| 135 | GSM506690 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 108 | GSM575247 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 98 | GSM575246 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 80 | GSM506684 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 61 | GSM506691 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 52 | GSM506683 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 50 | GSM506688 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 49 | GSM605662 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 46 | GSM506689 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 44 | GSM506664 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 41 | GSM605663 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 39 | GSM343002 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 39 | GSM343005 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 38 | GSM506685 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 37 | GSM343004 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 36 | GSM442935 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 36 | GSM506680 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 35 | GSM506686 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 35 | GSM605659 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 35 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 34 | GSM605664 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 33 | GSM506681 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 32 | GSM605658 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 30 | GSM506687 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 27 | GSM506666 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 23 | GSM605660 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 22 | GSM506660 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 22 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
| 20 | GSM277608 | Highly integrated single base resolution maps of the epigenome in Arabidopsis |
| 19 | GSM343001 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 19 | GSM506667 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 19 | GSM554062 | Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA. |
| 17 | GSM118372 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
| 17 | GSM442934 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 16 | GSM506659 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 15 | GSM277611 | Highly integrated single base resolution maps of the epigenome in Arabidopsis |
| 15 | GSM518430 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |
| 15 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 14 | GSM277610 | Highly integrated single base resolution maps of the epigenome in Arabidopsis |
| 14 | GSM506662 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 14 | GSM506671 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 14 | GSM605665 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 13 | GSM253623 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 13 | GSM506661 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 12 | GSM506665 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 12 | GSM506672 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 12 | GSM711892 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 11 | GSM304284 | ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing |
| 11 | GSM342999 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 11 | GSM605661 | Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0 |
| 10 | GSM343000 | AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing |
| 10 | GSM554063 | Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA. |
| 10 | GSM711891 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 9 | GSM506656 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 9 | GSM506679 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 8 | GSM277609 | Highly integrated single base resolution maps of the epigenome in Arabidopsis |
| 8 | GSM506658 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 8 | GSM506675 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 8 | GSM506678 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 8 | GSM518431 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |
| 8 | GSM518432 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |
| 7 | GSM506673 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 6 | GSM257236 | High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants |
| 5 | GSM304282 | ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing |
| 5 | GSM304285 | ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing |
| 5 | GSM506657 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 5 | GSM506669 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 5 | GSM506674 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 5 | GSM518390 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |
| 5 | GSM711893 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 5 | GSM711894 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 4 | GSM118374 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
| 4 | GSM257235 | High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants |
| 3 | GSM121455 | Small RNA identification in Arabidopsis thaliana using 454 data |
| 3 | GSM121457 | Small RNA identification in Arabidopsis thaliana using 454 data |
| 3 | GSM253624 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 3 | GSM366868 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing |
| 3 | GSM506668 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 3 | GSM506682 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 3 | GSM711895 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |
| 2 | GSM366870 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing |
| 2 | GSM387519 | Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids |
| 2 | GSM442933 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 2 | GSM506663 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 2 | GSM707686 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM118375 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
| 1 | GSM121453 | Small RNA identification in Arabidopsis thaliana using 454 data |
| 1 | GSM154368 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
| 1 | GSM257237 | High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants |
| 1 | GSM284747 | A link between RNA metabolism and silencing affecting Arabidopsis development |
| 1 | GSM284748 | A link between RNA metabolism and silencing affecting Arabidopsis development |
| 1 | GSM284749 | A link between RNA metabolism and silencing affecting Arabidopsis development |
| 1 | GSM284750 | A link between RNA metabolism and silencing affecting Arabidopsis development |
| 1 | GSM366869 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing |
| 1 | GSM385396 | Small RNAs in Arabidopsis hybrid siliques |
| 1 | GSM387518 | Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids |
| 1 | GSM387522 | Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids |
| 1 | GSM415784 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415785 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415786 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415787 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415788 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415789 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415792 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415794 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415796 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415797 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415798 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM415799 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM442932 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 1 | GSM456945 | Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4 |
| 1 | GSM506670 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506677 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM518439 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518443 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518445 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518446 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518447 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518456 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518457 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518458 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518460 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM518466 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM554064 | Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA. |
| 1 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |