Sequence

AGAGCUUCCUUGAGUCCAUU

Expression details
CountSample IDExperiment title
57GSM707690Characterization of AGO1-/AGO4-associated smRNAs
36GSM707691Characterization of AGO1-/AGO4-associated smRNAs
24GSM707678Characterization of AGO1-/AGO4-associated smRNAs
23GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
23GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
22GSM707685Characterization of AGO1-/AGO4-associated smRNAs
14GSM707679Characterization of AGO1-/AGO4-associated smRNAs
13GSM707682Characterization of AGO1-/AGO4-associated smRNAs
9GSM343004AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
9GSM707681Characterization of AGO1-/AGO4-associated smRNAs
6GSM707684Characterization of AGO1-/AGO4-associated smRNAs
5GSM277608Highly integrated single base resolution maps of the epigenome in Arabidopsis
5GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
4GSM605658Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
4GSM605659Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
4GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
3GSM506660Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM707683Characterization of AGO1-/AGO4-associated smRNAs
2GSM277610Highly integrated single base resolution maps of the epigenome in Arabidopsis
2GSM506658Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506666Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506678Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506685Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM518431MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
2GSM554065Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
2GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM253623Small RNAs in four Argonaute complexes in Arabidopsis
1GSM277609Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM284747A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM284750A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM342999AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM366868Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
1GSM415786Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415788Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415799Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM456944Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506679Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518447small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518456small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518467small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM575247Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM605663Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0