Sequence

GGAAUCUUGAUGAUGCUGCAUC

Expression details
CountSample IDExperiment title
9GSM707691Characterization of AGO1-/AGO4-associated smRNAs
2GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM707688Characterization of AGO1-/AGO4-associated smRNAs
2GSM707689Characterization of AGO1-/AGO4-associated smRNAs
1GSM118372High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM118374High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM149079Small RNAs in Arabidopsis thaliana and its RISC complexes
1GSM154336Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM154368Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM253624Small RNAs in four Argonaute complexes in Arabidopsis
1GSM284747A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM506657Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506681Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506685Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM707684Characterization of AGO1-/AGO4-associated smRNAs
1GSM707687Characterization of AGO1-/AGO4-associated smRNAs
1GSM707690Characterization of AGO1-/AGO4-associated smRNAs