Sequence

GCAGCACCAUUAAGAUUCACAA

Expression details
CountSample IDExperiment title
3GSM118372High-throughput sequencing of small RNAs from Arabidopsis thaliana
3GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
2GSM366866Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
2GSM506657Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
2GSM605662Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
2GSM605665Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM118375High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM257235High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
1GSM284748A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM415786Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415796Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415797Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415799Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518440small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518446small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518447small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518464small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM707679Characterization of AGO1-/AGO4-associated smRNAs
1GSM707680Characterization of AGO1-/AGO4-associated smRNAs