Sequence

CAGAUGCAGCACCAUUAAGAUU

Expression details
CountSample IDExperiment title
3GSM707691Characterization of AGO1-/AGO4-associated smRNAs
2GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM277610Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM506660Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi