Sequence

UGUUGGAGCAUCAUCAAGAU

Expression details
CountSample IDExperiment title
12GSM707690Characterization of AGO1-/AGO4-associated smRNAs
12GSM707691Characterization of AGO1-/AGO4-associated smRNAs
2GSM506664Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM707682Characterization of AGO1-/AGO4-associated smRNAs
1GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM707680Characterization of AGO1-/AGO4-associated smRNAs
1GSM707684Characterization of AGO1-/AGO4-associated smRNAs