Sequence

UCUUGAUGAUGCUGCAGCUGC

Expression details
CountSample IDExperiment title
5GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
4GSM506664Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM415784Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415786Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM456944Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM506678Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506679Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506681Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM605661Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM605662Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707691Characterization of AGO1-/AGO4-associated smRNAs