AGAAUCUUGAUGAUGCUGCAGCU
| Count | Sample ID | Experiment title |
|---|---|---|
| 15 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707686 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707688 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM118372 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
| 1 | GSM253624 | Small RNAs in four Argonaute complexes in Arabidopsis |
| 1 | GSM415790 | Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs |
| 1 | GSM456944 | Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4 |
| 1 | GSM456945 | Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4 |
| 1 | GSM506669 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506684 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |