Sequence

UGCUGCAUCAACAAUCGACGG

Expression details
CountSample IDExperiment title
30GSM518430MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
10GSM518431MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
2GSM387520Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
1GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518429MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana