UGCUGCAUCAACAAUCGACGG
| Count | Sample ID | Experiment title |
|---|---|---|
| 30 | GSM518430 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |
| 10 | GSM518431 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |
| 2 | GSM387520 | Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids |
| 1 | GSM506690 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM518429 | MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana |