Sequence

UCUUGAUGAUGCUGCAUCAACA

Expression details
CountSample IDExperiment title
8GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506656Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506683Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi