Sequence

AGGCGCAGCACCAUUAAGAUU

Expression details
CountSample IDExperiment title
15GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM506667Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM253624Small RNAs in four Argonaute complexes in Arabidopsis
1GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM491578Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506661Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi