Sequence

UGAUGAUGCUGCAUCGGCAAU

Expression details
CountSample IDExperiment title
20GSM518429MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
4GSM387517Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
1GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM707679Characterization of AGO1-/AGO4-associated smRNAs