Sequence

GAAUCUUGAUGAUGCUGCAU

Expression details
CountSample IDExperiment title
495GSM253622Small RNAs in four Argonaute complexes in Arabidopsis
412GSM149080Small RNAs in Arabidopsis thaliana and its RISC complexes
355GSM387517Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
319GSM707682Characterization of AGO1-/AGO4-associated smRNAs
276GSM707690Characterization of AGO1-/AGO4-associated smRNAs
257GSM154364Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
165GSM707691Characterization of AGO1-/AGO4-associated smRNAs
140GSM387513Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
137GSM154363Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
125GSM387515Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
122GSM707683Characterization of AGO1-/AGO4-associated smRNAs
116GSM387514Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
115GSM707679Characterization of AGO1-/AGO4-associated smRNAs
96GSM154367Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
83GSM707681Characterization of AGO1-/AGO4-associated smRNAs
69GSM149079Small RNAs in Arabidopsis thaliana and its RISC complexes
69GSM707685Characterization of AGO1-/AGO4-associated smRNAs
67GSM387521Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
63GSM707678Characterization of AGO1-/AGO4-associated smRNAs
62GSM387520Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
59GSM149081Small RNAs in Arabidopsis thaliana and its RISC complexes
55GSM707680Characterization of AGO1-/AGO4-associated smRNAs
48GSM253623Small RNAs in four Argonaute complexes in Arabidopsis
46GSM277608Highly integrated single base resolution maps of the epigenome in Arabidopsis
44GSM277610Highly integrated single base resolution maps of the epigenome in Arabidopsis
36GSM605659Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
34GSM154370Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
34GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
34GSM387522Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
30GSM154374Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
30GSM154377Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
29GSM387519Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
28GSM605658Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
25GSM387516Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
24GSM506664Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
22GSM424742smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
21GSM154336Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
19GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
19GSM518389MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
18GSM387518Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
17GSM707684Characterization of AGO1-/AGO4-associated smRNAs
16GSM121457Small RNA identification in Arabidopsis thaliana using 454 data
16GSM154368Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
16GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
15GSM154362Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
15GSM506681Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
14GSM118374High-throughput sequencing of small RNAs from Arabidopsis thaliana
14GSM154365Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
14GSM605663Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
12GSM277609Highly integrated single base resolution maps of the epigenome in Arabidopsis
11GSM121453Small RNA identification in Arabidopsis thaliana using 454 data
11GSM154372Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
11GSM506660Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
10GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
9GSM343004AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
9GSM506656Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
8GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
8GSM491577Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
8GSM605661Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
8GSM605662Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
7GSM253624Small RNAs in four Argonaute complexes in Arabidopsis
7GSM253625Small RNAs in four Argonaute complexes in Arabidopsis
7GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
6GSM118372High-throughput sequencing of small RNAs from Arabidopsis thaliana
6GSM118375High-throughput sequencing of small RNAs from Arabidopsis thaliana
6GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
6GSM491567Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
6GSM506663Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
6GSM518429MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
6GSM518431MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
6GSM707686Characterization of AGO1-/AGO4-associated smRNAs
5GSM154361Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
5GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
5GSM491568Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
5GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
5GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
5GSM506661Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
5GSM506688Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
5GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
5GSM518430MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
5GSM605660Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
5GSM605665Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
4GSM366865Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
4GSM366870Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
4GSM424743smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
4GSM518432MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
3GSM121455Small RNA identification in Arabidopsis thaliana using 454 data
3GSM154376Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
3GSM284747A link between RNA metabolism and silencing affecting Arabidopsis development
3GSM284748A link between RNA metabolism and silencing affecting Arabidopsis development
3GSM284749A link between RNA metabolism and silencing affecting Arabidopsis development
3GSM284750A link between RNA metabolism and silencing affecting Arabidopsis development
3GSM342999AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
3GSM343000AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
3GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
3GSM366866Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
3GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
3GSM491570Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
3GSM506657Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM506680Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM575247Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
3GSM605664Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
3GSM707688Characterization of AGO1-/AGO4-associated smRNAs
3GSM711894Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
3GSM711895Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
2GSM121454Small RNA identification in Arabidopsis thaliana using 454 data
2GSM491576Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM506683Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506687Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM518390MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM257237High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
1GSM366868Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
1GSM385393Small RNAs in Arabidopsis hybrid siliques
1GSM415783Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415784Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415785Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415786Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415787Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415788Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415789Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415790Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415791Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415792Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415793Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415794Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415796Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415797Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415799Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM424744smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
1GSM424745smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
1GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM456944Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM491571Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506658Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506675Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518391MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM518440small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518441small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518443small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518446small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518447small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518456small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518457small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518458small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518459small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518461small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518463small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518466small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518467small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM554062Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
1GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM707687Characterization of AGO1-/AGO4-associated smRNAs
1GSM711891Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings