Sequence

UGGCGGAAAGCGUCAUGUUUAG

Expression details
CountSample IDExperiment title
2GSM491578Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491575Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491579Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM518432MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM707679Characterization of AGO1-/AGO4-associated smRNAs
1GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM707691Characterization of AGO1-/AGO4-associated smRNAs