Sequence

AUAGCCAAGGAUGACUUGCCUG

Expression details
CountSample IDExperiment title
44GSM154377Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM118373High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM118374High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM284747A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM707684Characterization of AGO1-/AGO4-associated smRNAs
1GSM707691Characterization of AGO1-/AGO4-associated smRNAs