UAGCCAAGGAUGACUUGCCUGCU
| Count | Sample ID | Experiment title |
|---|---|---|
| 9 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM442932 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 2 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM442935 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 1 | GSM456944 | Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4 |
| 1 | GSM506680 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM518444 | small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues |
| 1 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |