UUAUAUGUUCUUCUCUUUCA
| Count | Sample ID | Experiment title |
|---|---|---|
| 51 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |
| 34 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 17 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 9 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM424742 | smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf |
| 1 | GSM366870 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing |
| 1 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |