UAUAUGUUCUUCUCUUUCAUCU
| Count | Sample ID | Experiment title |
|---|---|---|
| 6 | GSM366866 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) |
| 6 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 5 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 4 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM506680 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506686 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM512703 | Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves |
| 1 | GSM575246 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |