Sequence

UAUAUGUUCUUCUCUUUCAUCU

Expression details
CountSample IDExperiment title
6GSM366866Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
6GSM707679Characterization of AGO1-/AGO4-associated smRNAs
5GSM707685Characterization of AGO1-/AGO4-associated smRNAs
4GSM707684Characterization of AGO1-/AGO4-associated smRNAs
3GSM707680Characterization of AGO1-/AGO4-associated smRNAs
3GSM707691Characterization of AGO1-/AGO4-associated smRNAs
2GSM707681Characterization of AGO1-/AGO4-associated smRNAs
2GSM707683Characterization of AGO1-/AGO4-associated smRNAs
1GSM506680Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM512703Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis