Sequence

UUGAGCCAAGGAUGACUUGCCG

Expression details
CountSample IDExperiment title
2GSM154377Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
2GSM277610Highly integrated single base resolution maps of the epigenome in Arabidopsis
2GSM424742smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
2GSM491574Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM491576Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM575247Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM257235High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM456944Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM707690Characterization of AGO1-/AGO4-associated smRNAs
1GSM711895Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings