UCCGGCAAGUUGACCUUGGCUCU
| Count | Sample ID | Experiment title |
|---|---|---|
| 2 | GSM284747 | A link between RNA metabolism and silencing affecting Arabidopsis development |
| 1 | GSM456944 | Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4 |
| 1 | GSM456945 | Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4 |