Sequence

GCAAGUUGACCUUGGCUCUGUUU

Expression details
CountSample IDExperiment title
5GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
3GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
3GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM343004AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM506679Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM707688Characterization of AGO1-/AGO4-associated smRNAs
1GSM506657Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM605662Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707678Characterization of AGO1-/AGO4-associated smRNAs
1GSM707680Characterization of AGO1-/AGO4-associated smRNAs
1GSM707687Characterization of AGO1-/AGO4-associated smRNAs