Sequence

CCGGCAAGUUGACCUUGGCUC

Expression details
CountSample IDExperiment title
2GSM284749A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM415799Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM456944Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM605661Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM707685Characterization of AGO1-/AGO4-associated smRNAs