Sequence

CAAGUUGACCUUGGCUCUGUU

Expression details
CountSample IDExperiment title
5GSM707680Characterization of AGO1-/AGO4-associated smRNAs
4GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
4GSM707691Characterization of AGO1-/AGO4-associated smRNAs
3GSM707681Characterization of AGO1-/AGO4-associated smRNAs
2GSM605659Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
2GSM707678Characterization of AGO1-/AGO4-associated smRNAs
2GSM707685Characterization of AGO1-/AGO4-associated smRNAs
1GSM118375High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM366867Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
1GSM415786Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM506658Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506676Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506683Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518447small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM707684Characterization of AGO1-/AGO4-associated smRNAs
1GSM707690Characterization of AGO1-/AGO4-associated smRNAs