Sequence

AGAGAAUGAGGUUGAGCCAAG

Expression details
CountSample IDExperiment title
2GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM118375High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM284749A link between RNA metabolism and silencing affecting Arabidopsis development
1GSM385395Small RNAs in Arabidopsis hybrid siliques
1GSM415786Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM707678Characterization of AGO1-/AGO4-associated smRNAs