Sequence

UGAAGGAAUAACGAAUGGAA

Expression details
CountSample IDExperiment title
7GSM707683Characterization of AGO1-/AGO4-associated smRNAs
6GSM707685Characterization of AGO1-/AGO4-associated smRNAs
4GSM707679Characterization of AGO1-/AGO4-associated smRNAs
4GSM707691Characterization of AGO1-/AGO4-associated smRNAs
1GSM424744smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
1GSM424745smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
1GSM491567Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491569Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491573Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM518462small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM707682Characterization of AGO1-/AGO4-associated smRNAs
1GSM707684Characterization of AGO1-/AGO4-associated smRNAs