Sequence

GCAAGUUGACCUUGGCUCUGCUU

Expression details
CountSample IDExperiment title
3GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
3GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
3GSM707687Characterization of AGO1-/AGO4-associated smRNAs
2GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM707679Characterization of AGO1-/AGO4-associated smRNAs
2GSM707688Characterization of AGO1-/AGO4-associated smRNAs
1GSM118374High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM366868Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
1GSM491571Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491579Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM707684Characterization of AGO1-/AGO4-associated smRNAs