Sequence

GCAAGUUGACCUUGGCUCUGCU

Expression details
CountSample IDExperiment title
25GSM707679Characterization of AGO1-/AGO4-associated smRNAs
12GSM343004AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
12GSM707680Characterization of AGO1-/AGO4-associated smRNAs
11GSM491567Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
8GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
7GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
6GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
6GSM707688Characterization of AGO1-/AGO4-associated smRNAs
5GSM491570Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
5GSM491571Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
4GSM707678Characterization of AGO1-/AGO4-associated smRNAs
4GSM707681Characterization of AGO1-/AGO4-associated smRNAs
3GSM491569Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
3GSM491574Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
3GSM491576Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM342999AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM366865Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
2GSM366866Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
2GSM506657Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506673Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM707684Characterization of AGO1-/AGO4-associated smRNAs
1GSM366867Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
1GSM415786Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM491568Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491573Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491578Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506656Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506660Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506661Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506678Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518432MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM707687Characterization of AGO1-/AGO4-associated smRNAs