Sequence

GAGCCAAGGAUGACUUGCCG

Expression details
CountSample IDExperiment title
22GSM277610Highly integrated single base resolution maps of the epigenome in Arabidopsis
10GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
9GSM277608Highly integrated single base resolution maps of the epigenome in Arabidopsis
5GSM491571Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
5GSM491577Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
4GSM284747A link between RNA metabolism and silencing affecting Arabidopsis development
4GSM284749A link between RNA metabolism and silencing affecting Arabidopsis development
4GSM284750A link between RNA metabolism and silencing affecting Arabidopsis development
4GSM707690Characterization of AGO1-/AGO4-associated smRNAs
3GSM387514Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
3GSM491576Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
3GSM707685Characterization of AGO1-/AGO4-associated smRNAs
2GSM506663Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506682Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
2GSM707682Characterization of AGO1-/AGO4-associated smRNAs
2GSM707691Characterization of AGO1-/AGO4-associated smRNAs
1GSM121453Small RNA identification in Arabidopsis thaliana using 454 data
1GSM121455Small RNA identification in Arabidopsis thaliana using 454 data
1GSM257237High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
1GSM277609Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM387516Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
1GSM387518Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
1GSM387521Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
1GSM415783Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415799Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM456944Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM491567Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506672Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506674Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506685Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM575247Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM707683Characterization of AGO1-/AGO4-associated smRNAs