Sequence

CAAGUUGACCUUGGCUCUGC

Expression details
CountSample IDExperiment title
3GSM491569Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
3GSM491574Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
3GSM491577Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
3GSM491578Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM366865Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
2GSM491567Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM491579Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM707679Characterization of AGO1-/AGO4-associated smRNAs
1GSM154372Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM366866Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
1GSM366867Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
1GSM491570Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518432MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM707691Characterization of AGO1-/AGO4-associated smRNAs