ACCUUGGCUCUGCUUCGUUCU
| Count | Sample ID | Experiment title |
|---|---|---|
| 1 | GSM118374 | High-throughput sequencing of small RNAs from Arabidopsis thaliana |
| 1 | GSM366865 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) |
| 1 | GSM506689 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |