Sequence

GCAAGUUGACUUUGGCUCUGUU

Expression details
CountSample IDExperiment title
46GSM707680Characterization of AGO1-/AGO4-associated smRNAs
27GSM707681Characterization of AGO1-/AGO4-associated smRNAs
19GSM707679Characterization of AGO1-/AGO4-associated smRNAs
9GSM707678Characterization of AGO1-/AGO4-associated smRNAs
4GSM605661Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
4GSM605665Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
3GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
3GSM343004AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
3GSM605664Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
2GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM342999AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM415786Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM424848Low oxygen responsive small RNAs in Arabidopsis
1GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM491576Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506658Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506663Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506681Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518440small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518443small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518444small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518446small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518447small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518451small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518452small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518453small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518454small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518455small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518459small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518462small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518463small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM707688Characterization of AGO1-/AGO4-associated smRNAs