UUGAGCCAAGGAUGACUUGCC
| Count | Sample ID | Experiment title |
|---|---|---|
| 70 | GSM707691 | Characterization of AGO1-/AGO4-associated smRNAs |
| 33 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 27 | GSM707684 | Characterization of AGO1-/AGO4-associated smRNAs |
| 16 | GSM707683 | Characterization of AGO1-/AGO4-associated smRNAs |
| 14 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |
| 6 | GSM707682 | Characterization of AGO1-/AGO4-associated smRNAs |
| 5 | GSM707679 | Characterization of AGO1-/AGO4-associated smRNAs |
| 4 | GSM707690 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM707678 | Characterization of AGO1-/AGO4-associated smRNAs |
| 2 | GSM442933 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |
| 2 | GSM491572 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 2 | GSM506686 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 2 | GSM707681 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM154367 | Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology |
| 1 | GSM277611 | Highly integrated single base resolution maps of the epigenome in Arabidopsis |
| 1 | GSM366866 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) |
| 1 | GSM387516 | Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids |
| 1 | GSM456944 | Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4 |
| 1 | GSM456945 | Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4 |
| 1 | GSM491567 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM491576 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM506656 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506660 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506680 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506690 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM506691 | Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi |
| 1 | GSM575247 | Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis |
| 1 | GSM707688 | Characterization of AGO1-/AGO4-associated smRNAs |