Sequence

GCAAGUUGACCUUGGCUCUGU

Expression details
CountSample IDExperiment title
1014GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
820GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
752GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
554GSM506667Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
543GSM506659Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
490GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
448GSM506666Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
431GSM506685Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
398GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
396GSM707678Characterization of AGO1-/AGO4-associated smRNAs
390GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
389GSM707680Characterization of AGO1-/AGO4-associated smRNAs
347GSM506683Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
265GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
263GSM506661Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
249GSM506660Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
244GSM506664Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
243GSM707681Characterization of AGO1-/AGO4-associated smRNAs
190GSM506681Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
174GSM707679Characterization of AGO1-/AGO4-associated smRNAs
160GSM506682Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
155GSM506688Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
130GSM343004AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
114GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
104GSM506679Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
100GSM506657Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
99GSM506678Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
99GSM518432MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
95GSM506663Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
85GSM506673Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
83GSM506687Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
82GSM506656Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
80GSM506680Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
69GSM506662Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
66GSM366868Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
66GSM506677Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
62GSM506671Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
59GSM506658Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
56GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
53GSM518429MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
48GSM506672Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
39GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
39GSM506669Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
38GSM366870Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
37GSM506670Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
33GSM491567Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
32GSM342999AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
31GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
29GSM506668Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
29GSM506674Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
27GSM605660Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
27GSM605665Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
26GSM506676Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
25GSM605659Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
21GSM605658Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
20GSM366866Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
20GSM506675Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
20GSM605662Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
17GSM366865Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
17GSM554062Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
15GSM366867Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
14GSM343000AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
13GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
12GSM304283ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
12GSM554063Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
12GSM605664Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
11GSM491569Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
9GSM118375High-throughput sequencing of small RNAs from Arabidopsis thaliana
9GSM385396Small RNAs in Arabidopsis hybrid siliques
9GSM491573Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
9GSM707691Characterization of AGO1-/AGO4-associated smRNAs
8GSM304284ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
8GSM491576Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
7GSM304282ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
7GSM366869Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
7GSM491570Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
7GSM605661Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
6GSM491571Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
6GSM518390MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
5GSM149079Small RNAs in Arabidopsis thaliana and its RISC complexes
5GSM385395Small RNAs in Arabidopsis hybrid siliques
5GSM491574Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
5GSM707688Characterization of AGO1-/AGO4-associated smRNAs
4GSM118374High-throughput sequencing of small RNAs from Arabidopsis thaliana
4GSM605663Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
3GSM118372High-throughput sequencing of small RNAs from Arabidopsis thaliana
3GSM491578Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM118373High-throughput sequencing of small RNAs from Arabidopsis thaliana
2GSM121453Small RNA identification in Arabidopsis thaliana using 454 data
2GSM121455Small RNA identification in Arabidopsis thaliana using 454 data
2GSM121457Small RNA identification in Arabidopsis thaliana using 454 data
2GSM284747A link between RNA metabolism and silencing affecting Arabidopsis development
2GSM284748A link between RNA metabolism and silencing affecting Arabidopsis development
2GSM284749A link between RNA metabolism and silencing affecting Arabidopsis development
2GSM284750A link between RNA metabolism and silencing affecting Arabidopsis development
2GSM385393Small RNAs in Arabidopsis hybrid siliques
2GSM424847Low oxygen responsive small RNAs in Arabidopsis
2GSM518430MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
2GSM518431MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM154375Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
1GSM385394Small RNAs in Arabidopsis hybrid siliques
1GSM387520Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
1GSM415783Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415784Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415785Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415786Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415789Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415799Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM424848Low oxygen responsive small RNAs in Arabidopsis
1GSM456944Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM491568Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491575Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491579Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM518442small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518443small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518444small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518445small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518446small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518448small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518450small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518452small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518453small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518454small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518456small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518460small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518461small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518462small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518463small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM575247Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM707683Characterization of AGO1-/AGO4-associated smRNAs
1GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
1GSM711895Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings