Sequence

CAGCCAAGGAUGACUUGCCGGUA

Expression details
CountSample IDExperiment title
139GSM154377Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
3GSM707680Characterization of AGO1-/AGO4-associated smRNAs
1GSM304284ARGONAUTE-small RNA Interactions in Arabidopsis thaliana Identified by High-Throughput Sequencing
1GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM366870Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
1GSM387519Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
1GSM387522Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
1GSM491567Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491571Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM518432MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM554063Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
1GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM707685Characterization of AGO1-/AGO4-associated smRNAs
1GSM707689Characterization of AGO1-/AGO4-associated smRNAs
1GSM707691Characterization of AGO1-/AGO4-associated smRNAs