Sequence

CAGCCAAGGAUGACUUGCCGGU

Expression details
CountSample IDExperiment title
891GSM154377Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
47GSM707685Characterization of AGO1-/AGO4-associated smRNAs
36GSM707691Characterization of AGO1-/AGO4-associated smRNAs
31GSM707680Characterization of AGO1-/AGO4-associated smRNAs
27GSM491568Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
24GSM707681Characterization of AGO1-/AGO4-associated smRNAs
17GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
17GSM491571Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
16GSM253622Small RNAs in four Argonaute complexes in Arabidopsis
12GSM491567Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
11GSM118374High-throughput sequencing of small RNAs from Arabidopsis thaliana
11GSM366865Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
10GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
9GSM366867Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
8GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
7GSM387518Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
7GSM491574Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
7GSM491577Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
6GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
6GSM491575Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
6GSM491576Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
6GSM518429MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
6GSM518432MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
6GSM707678Characterization of AGO1-/AGO4-associated smRNAs
5GSM343004AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
5GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
5GSM707684Characterization of AGO1-/AGO4-associated smRNAs
4GSM149079Small RNAs in Arabidopsis thaliana and its RISC complexes
4GSM366866Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
4GSM387519Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
4GSM387522Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
4GSM506661Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
4GSM506689Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM253625Small RNAs in four Argonaute complexes in Arabidopsis
3GSM257236High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
3GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
3GSM387514Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
3GSM506656Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM506666Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM506686Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
3GSM554062Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
3GSM707679Characterization of AGO1-/AGO4-associated smRNAs
3GSM707690Characterization of AGO1-/AGO4-associated smRNAs
3GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
3GSM711895Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
2GSM121454Small RNA identification in Arabidopsis thaliana using 454 data
2GSM154376Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
2GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM387516Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
2GSM424848Low oxygen responsive small RNAs in Arabidopsis
2GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
2GSM491572Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM491573Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM506663Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506664Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506682Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506683Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM518392MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
2GSM554064Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
2GSM554065Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
2GSM707682Characterization of AGO1-/AGO4-associated smRNAs
1GSM118372High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM257235High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
1GSM257237High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
1GSM366870Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
1GSM415785Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415799Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM424743smRNAs in wildtype and RDR6-15 knockout Arabidopsis thaliana Col-0 leaf
1GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM456944Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM491569Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491570Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491579Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506657Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506685Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506688Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM512702Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM512703Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM518390MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
1GSM518444small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518453small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518454small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518460small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518462small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM575247Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM707683Characterization of AGO1-/AGO4-associated smRNAs
1GSM707687Characterization of AGO1-/AGO4-associated smRNAs
1GSM707688Characterization of AGO1-/AGO4-associated smRNAs
1GSM707689Characterization of AGO1-/AGO4-associated smRNAs
1GSM711893Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings