UUUUGCUCUCUUCUUCUCAUG
| Count | Sample ID | Experiment title |
|---|---|---|
| 4 | GSM707680 | Characterization of AGO1-/AGO4-associated smRNAs |
| 3 | GSM366865 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) |
| 3 | GSM366867 | Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) |
| 1 | GSM442933 | Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing |