Sequence

UGUCCUUCGGCUACAUUUUGCU

Expression details
CountSample IDExperiment title
2GSM366867Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
1GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM518461small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM554062Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
1GSM707680Characterization of AGO1-/AGO4-associated smRNAs
1GSM711895Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings