Sequence

UGGCAAGUUGUCCUUCGGCUACA

Expression details
CountSample IDExperiment title
3GSM707691Characterization of AGO1-/AGO4-associated smRNAs
2GSM707680Characterization of AGO1-/AGO4-associated smRNAs
2GSM707685Characterization of AGO1-/AGO4-associated smRNAs
1GSM118374High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM149079Small RNAs in Arabidopsis thaliana and its RISC complexes
1GSM253622Small RNAs in four Argonaute complexes in Arabidopsis
1GSM518460small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM707689Characterization of AGO1-/AGO4-associated smRNAs