Sequence

UGGCAAGUUGUCCUUCGGCUAC

Expression details
CountSample IDExperiment title
247GSM707691Characterization of AGO1-/AGO4-associated smRNAs
108GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
102GSM707685Characterization of AGO1-/AGO4-associated smRNAs
68GSM442932Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
65GSM707684Characterization of AGO1-/AGO4-associated smRNAs
33GSM518430MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
33GSM707680Characterization of AGO1-/AGO4-associated smRNAs
30GSM518431MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
18GSM154377Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
17GSM387522Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
17GSM711895Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
14GSM118374High-throughput sequencing of small RNAs from Arabidopsis thaliana
11GSM707681Characterization of AGO1-/AGO4-associated smRNAs
11GSM707683Characterization of AGO1-/AGO4-associated smRNAs
10GSM711894Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
9GSM711891Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
8GSM554065Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
6GSM277611Highly integrated single base resolution maps of the epigenome in Arabidopsis
6GSM518429MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
5GSM387519Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
5GSM442935Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
5GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings
4GSM149079Small RNAs in Arabidopsis thaliana and its RISC complexes
4GSM343004AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
3GSM343002AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
3GSM387518Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
3GSM387521Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
3GSM518432MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
3GSM605659Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
3GSM605661Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
3GSM605664Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
3GSM605665Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
3GSM707688Characterization of AGO1-/AGO4-associated smRNAs
3GSM707690Characterization of AGO1-/AGO4-associated smRNAs
2GSM253625Small RNAs in four Argonaute complexes in Arabidopsis
2GSM277609Highly integrated single base resolution maps of the epigenome in Arabidopsis
2GSM343005AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
2GSM366865Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
2GSM387514Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
2GSM387516Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
2GSM387517Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
2GSM442934Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
2GSM506661Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM506677Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM605658Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
2GSM707679Characterization of AGO1-/AGO4-associated smRNAs
2GSM707682Characterization of AGO1-/AGO4-associated smRNAs
1GSM277608Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM277610Highly integrated single base resolution maps of the epigenome in Arabidopsis
1GSM342999AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM366867Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
1GSM366868Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
1GSM415784Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415785Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415786Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415791Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415792Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415798Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM415799Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM491577Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506656Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506663Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506681Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506683Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506684Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM512702Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM512703Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves
1GSM518442small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518448small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518453small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518460small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518462small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518463small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM518465small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM554063Global identification of Arabidopsis thaliana ARGONAUTE1-associated small RNA.
1GSM575246Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM575247Genome-wide double-stranded RNA sequencing reveals the functional significance of base-paired RNAs in Arabidopsis
1GSM605660Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM605663Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM711893Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings