Sequence

UGGCAAGUUGUCCUUCGGCUA

Expression details
CountSample IDExperiment title
8GSM707691Characterization of AGO1-/AGO4-associated smRNAs
5GSM707685Characterization of AGO1-/AGO4-associated smRNAs
2GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
2GSM506682Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM366870Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing
1GSM415790Arabidopsis Argonaute4, Argonaute6 and Argonaute9 associated small RNAs
1GSM506690Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM518463small RNAs sequences from grafted Arabidopsis thaliana and Nicotiana benthamiana tissues
1GSM707684Characterization of AGO1-/AGO4-associated smRNAs
1GSM707689Characterization of AGO1-/AGO4-associated smRNAs
1GSM711892Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings