Sequence

UGCAGCCAAGGAUGACUUGCCG

Expression details
CountSample IDExperiment title
5GSM154377Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
2GSM387514Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
1GSM257235High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
1GSM456945Deep sequencing of small RNAs in the trasngenic wild type plant and the IWR1-type transcription factor mutant, dms4
1GSM491577Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM707679Characterization of AGO1-/AGO4-associated smRNAs
1GSM707680Characterization of AGO1-/AGO4-associated smRNAs
1GSM707683Characterization of AGO1-/AGO4-associated smRNAs