Sequence

UGCAGCCAAGGAUGACUUGC

Expression details
CountSample IDExperiment title
74GSM707691Characterization of AGO1-/AGO4-associated smRNAs
49GSM707685Characterization of AGO1-/AGO4-associated smRNAs
31GSM707683Characterization of AGO1-/AGO4-associated smRNAs
22GSM154377Arabidopsis thaliana small RNAs sequences identified using high-throughput 454 sequencing technology
21GSM707684Characterization of AGO1-/AGO4-associated smRNAs
15GSM707679Characterization of AGO1-/AGO4-associated smRNAs
10GSM707682Characterization of AGO1-/AGO4-associated smRNAs
5GSM707680Characterization of AGO1-/AGO4-associated smRNAs
3GSM707690Characterization of AGO1-/AGO4-associated smRNAs
2GSM118374High-throughput sequencing of small RNAs from Arabidopsis thaliana
2GSM257235High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
2GSM387513Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
2GSM707678Characterization of AGO1-/AGO4-associated smRNAs
2GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM118372High-throughput sequencing of small RNAs from Arabidopsis thaliana
1GSM253622Small RNAs in four Argonaute complexes in Arabidopsis
1GSM257236High-throughput pyrosequencing of endogenous small RNAs from Arabidopsis thaliana wild-type and polIV mutants
1GSM387514Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids
1GSM491570Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM491576Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM512703Genome-wide maps of AGO1-bound small RNA in Arabidopsis leaves