Sequence

UCUGGCAAGUUGUCCUUCGGC

Expression details
CountSample IDExperiment title
4GSM707691Characterization of AGO1-/AGO4-associated smRNAs
2GSM506663Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
2GSM707681Characterization of AGO1-/AGO4-associated smRNAs
1GSM366866Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)
1GSM442933Uncovering small RNA-mediated responses to phosphate-deficiency in Arabidopsis by deep sequencing
1GSM605661Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM605664Homology-guided Assembly of the Genomes of the Four Diverse Accessions Ler, C24, Bur-0 and Kro-0
1GSM711891Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings