UAUAAUGCAGCCAAGGAUGAC
| Count | Sample ID | Experiment title |
|---|---|---|
| 2 | GSM707685 | Characterization of AGO1-/AGO4-associated smRNAs |
| 1 | GSM491567 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM491571 | Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria |
| 1 | GSM711892 | Small RNA sequencing in nine-day old nutrient-replete and N or P-limited wild type Arabidopsis seedlings |