Sequence

GCCAAGGAUGACUUGCCGGAA

Expression details
CountSample IDExperiment title
6GSM518429MIRNA Gene Evolution in Arabidopsis lyrata and Arabidopsis thaliana
2GSM491568Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
2GSM506662Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM343001AGO1-dependent Small RNA in Arabidopsis Identified by High-Throughput Sequencing
1GSM491567Genome-wide analysis of siRNA accumulation in Arabidopsis treated with bacteria
1GSM506665Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi
1GSM506691Accumulation of TuMV-derived siRNAs in aerial parts of Arabidopsis thaliana plants at 7 and 10 dpi